HES6 (NM_001282434) Human Untagged Clone

CAT#: SC333584

HES6 (untagged) - Human hes family bHLH transcription factor 6 (HES6), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HES6
• Synonyms: bHLHb41; bHLHc23; C-HAIRY1; HES-6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282434, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCCACCCGCGGCGCCTGGCCGGGACCGTGTGGGCCGTGAGGATGAGGACGGCTGGGAGACGCGAG
  GGGACCGCAAGGCCCGGAAGCCCCTGGTGGAGAAGAAGCGGCGCGCGCGGATCAACGAGAGCCTGCAGGA
  GCTGCGGCTGCTGCTGGCGGGCGCCGAGGTGCAGGCCAAGCTGGAGAACGCCGAAGTGCTGGAGCTGACG
  AGCGCGAGCAGCTGCAGGCGGAAGCGAGCGAGCGCTTCGCTGCCGGCTACATCCAGTGCATGCACGAGGT
  GCACACGTTCGTGTCCACGTGCCAGGCCATCGACGCTACCGTCGCTGCCGAGCTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282434
• ORF Size: 339 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282434.1, NP_001269363.1
• RefSeq Size: 1430
• RefSeq ORF: 339
• Locus ID: 55502
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a member of a subfamily of basic helix-loop-helix transcription repressors that have homology to the Drosophila enhancer of split genes. Members of this gene family regulate cell differentiation in numerous cell types. The protein encoded by this gene functions as a cofactor, interacting with other transcription factors through a tetrapeptide domain in its C-terminus. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
  Transcript Variant: This variant (3) uses an alternate splice donor site which results in a frameshift compared to variant 1. The encoded isoform (c) is shorter and has a novel C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.