MRAP (NM_001285394) Human Untagged Clone

CAT#: SC333594

MRAP (untagged) - Human melanocortin 2 receptor accessory protein (MRAP), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRAP
• Synonyms: B27; C21orf61; FALP; FGD2; GCCD2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001285394, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTGGTCCGCCTCCCCGCAGATGAGGAACAGCCCCAAGCACCACCAAACATGCCCCTGGAGTCACG
  GCCTCAACCTCCACCTCTGCATCCAGAAGTGCCTGCCGTGCCACAGGGAACCCCTGGCAACCTCACAGGC
  TCAGGCGAGCTCAGTGGAGCCAGGGAGCAGAACTGGCCCTGACCAGCCGCTACGACAGGAGAGCTCCTCC
  ACCTTGCCCCTCGGGGGTTTCCAGACCCACCCCACTCTCCTCTGGGAACTGACCCTCAATGGGGGTCCCC
  TCGTCAGGAGCAAGCCCAGCGAGCCTCCCCCTGGAGACAGGACCTCTCAATTGCAGAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001285394
• ORF Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001285394.1, NP_001272323.1
• RefSeq Size: 876
• RefSeq ORF: 342
• Locus ID: 56246
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a melanocortin receptor-interacting protein. The encoded protein regulates trafficking and function of the melanocortin 2 receptor in the adrenal gland. The encoded protein can also modulate signaling of other melanocortin receptors. Mutations in this gene have been associated with familial glucocorticoid deficiency type 2. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (3) lacks a coding exon compared to variant 1. The resulting isoform (c) has a shorter N-terminus compared to isoform alpha. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.