TMEM14B (NM_001286489) Human Untagged Clone

CAT#: SC333641

TMEM14B (untagged) - Human transmembrane protein 14B (TMEM14B), transcript variant 5


  "NM_001286489" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM14B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM14B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286489, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAGCCCCTCTTCCCATTAGTGCCTTTGCATTGGTTTGGCTTTGGCTACACAGCACTGGTTGTTT
CTGGTGGGATCGTTGGCTATGTAAAAACAGCCGCTACATCTGTTACTTTTGTTGGTGTTATGGGAATGAG
ATCCTACTACTATGGAAAATTCATGCCTGTAGGTTTAATTGCAGGTGCCAGATGGAGTATGGCTCTTGTT
GCCCAAGCTGGGGTGCAATGGTGCGATCTCAGCTCATTGCAACCTCCACCTCCCAGGTTCAAGCGATTCT
CCTGCCTTACCCTCCTGAGTAGCTGGGATTTCAGGTGTGCACCACCACACCCAGCTAATTTTTTGTATTT
TTAG


Restriction Sites SgfI-MluI     
ACCN NM_001286489
ORF Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286489.1, NP_001273418.1
RefSeq Size 1209
RefSeq ORF 354
Locus ID 81853
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.