MTLRP (GHRL) (NM_001302821) Human Untagged Clone
CAT#: SC333643
GHRL (untagged) - Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 8
"NM_001302821" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GHRL |
Synonyms | MTLRP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302821, the custom clone sequence may differ by one or more nucleotides
ATGCCCTCCCCAGGGACCGTCTGCAGCCTCCTGCTCCTCGGCATGCTCTGGCTGGACTTGGCCATGGCAG GCTCCAGCTTCCTGAGCCCTGAACACCAGAGAGTCCAGCAGAGAAAGGAGTCGAAGAAGCCACCAGCCAA GCTGCAGCCCCGAGCTCTAGCAGGCTGGCTCCGCCCGGAAGATGGAGGTCAAGCAGAAGGGGCAGAGGAT GAACTGGAAGTCCGGTTCAACGCCCCCTTTGATGTTGGAATCAAGCTGTCAGGGGTTCAGTACCAGCAGC ACAGCCAGGCCCTGGGGAAGTTTCTTCAGGACATCCTCTGGGAAGAGGCCAAAGAGGCCCCAGCCGACAA GTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302821 |
ORF Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001302821.1, NP_001289750.1 |
RefSeq Size | 1125 |
RefSeq ORF | 354 |
Locus ID | 51738 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | This gene encodes the ghrelin-obestatin preproprotein that is cleaved to yield two peptides, ghrelin and obestatin. Ghrelin is a powerful appetite stimulant and plays an important role in energy homeostasis. Its secretion is initiated when the stomach is empty, whereupon it binds to the growth hormone secretagogue receptor in the hypothalamus which results in the secretion of growth hormone (somatotropin). Ghrelin is thought to regulate multiple activities, including hunger, reward perception via the mesolimbic pathway, gastric acid secretion, gastrointestinal motility, and pancreatic glucose-stimulated insulin secretion. It was initially proposed that obestatin plays an opposing role to ghrelin by promoting satiety and thus decreasing food intake, but this action is still debated. Recent reports suggest multiple metabolic roles for obestatin, including regulating adipocyte function and glucose metabolism. Alternative splicing results in multiple transcript variants. In addition, antisense transcripts for this gene have been identified and may potentially regulate ghrelin-obestatin preproprotein expression. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (8) differs in the 5' UTR compared to variant 1. This isoform (8) contains the ligands ghrelin-28 and obestatin. Variants 1, 8, 9, 11 and 12 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235749 | GHRL (myc-DDK-tagged) - Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 8 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review