UBE2D3 (NM_001300795) Human Untagged Clone
CAT#: SC333647
UBE2D3 (untagged) - Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 10
"NM_001300795" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2D3 |
Synonyms | E2(17)KB3; UBC4/5; UBCH5C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300795, the custom clone sequence may differ by one or more nucleotides
ATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCATATCAAGGCGGTGTATTCTTTTTGA CAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTGCATTTACAACAAGAATTTATCATCC AAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGATCACAGTGGTCGCCTGCTTTAACAATT TCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAACCCAGATGACCCCCTAGTGCCAGAGA TTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATATCTCGGGAATGGACTCAGAAGTATGC CATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300795 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300795.1, NP_001287724.1 |
RefSeq Size | 3669 bp |
RefSeq ORF | 357 bp |
Locus ID | 7323 |
Cytogenetics | 4q24 |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]' Transcript Variant: This variant (10) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235753 | UBE2D3 (myc-DDK-tagged) - Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 10 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review