UBE2D3 (NM_001300795) Human Untagged Clone

CAT#: SC333647

UBE2D3 (untagged) - Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 10


  "NM_001300795" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2D3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2D3
Synonyms E2(17)KB3; UBC4/5; UBCH5C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300795, the custom clone sequence may differ by one or more nucleotides


ATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCATATCAAGGCGGTGTATTCTTTTTGA
CAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTGCATTTACAACAAGAATTTATCATCC
AAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGATCACAGTGGTCGCCTGCTTTAACAATT
TCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAACCCAGATGACCCCCTAGTGCCAGAGA
TTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATATCTCGGGAATGGACTCAGAAGTATGC
CATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001300795
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300795.1, NP_001287724.1
RefSeq Size 3669 bp
RefSeq ORF 357 bp
Locus ID 7323
Cytogenetics 4q24
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]'
Transcript Variant: This variant (10) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.