HMGA2 (NM_001300918) Human Untagged Clone

CAT#: SC333654

HMGA2 (untagged) - Human high mobility group AT-hook 2 (HMGA2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HMGA2
• Synonyms: BABL; HMGI-C; HMGIC; LIPO; STQTL9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300918, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCGCACGCGGTGAGGGCGCGGGGCAGCCGTCCACTTCAGCCCAGGGACAACCTGCCGCCCCAGCGC
  CTCAGAAGAGAGGACGCGGCCGCCCCAGGAAGCAGCAGCAAGAACCAACCGGTGAGCCCTCTCCTAAGAG
  ACCCAGGGGAAGACCCAAAGGCAGCAAAAACAAGAGTCCCTCTAAAGCAGCTCAAAAGAAAGCAGAAGCC
  ACTGGAGAAAAACGGCCAAGAGGCAGACCTAGGAAATGGCCACAACAAGTTGTTCAGAAGAAGCCTGCTC
  AGGTCAATGTTGCCTTGCCTGGGAAGGACCACCCGGGCAATCTTATATATCTACTGTTCTCTAAAAATGC
  CACTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300918
• ORF Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300918.1, NP_001287847.1
• RefSeq Size: 1274
• RefSeq ORF: 357
• Locus ID: 8091
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that belongs to the non-histone chromosomal high mobility group (HMG) protein family. HMG proteins function as architectural factors and are essential components of the enhancesome. This protein contains structural DNA-binding domains and may act as a transcriptional regulating factor. Identification of the deletion, amplification, and rearrangement of this gene that are associated with myxoid liposarcoma suggests a role in adipogenesis and mesenchymal differentiation. A gene knock out study of the mouse counterpart demonstrated that this gene is involved in diet-induced obesity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus, and is longer, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.