IFI27 (NM_001288957) Human Untagged Clone

CAT#: SC333657

IFI27 (untagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 6


  "NM_001288957" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IFI27"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFI27
Synonyms FAM14D; ISG12; ISG12A; P27
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001288957, the custom clone sequence may differ by one or more nucleotides


ATGGAGGCCTCTGCTCTCACCTCATCAGCAGTGACCAGTGTGGCCAAAGTGGTCAGGGTGGCCTCTGGCT
CTGCCGTAGTTTTGCCCCTGGCCAGGATTGCTACAGTTGTGATTGGAGGAGTTGTGGCTGTGCCCATGGT
GCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATAGCAGCCAAGATGATGTCCGCG
GCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCTACTCTGCAGTCACTGGGAGCAA
CTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTGCCATTGCGGCTGTCATTGCGAG
GTTCTACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288957
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288957.1, NP_001275886.1
RefSeq Size 737 bp
RefSeq ORF 360 bp
Locus ID 3429
Cytogenetics 14q32.12
Protein Families Transmembrane
Gene Summary ''
Transcript Variant: This variant (6) differs in the 5' UTR and lacks a 9-nt segment in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal 3 aa segment, as compared to isoform 1. Variants 2, 4, 6, 7 and 10 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.