IFI27 (NM_001288958) Human Untagged Clone
CAT#: SC333658
IFI27 (untagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 7
"NM_001288958" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFI27 |
Synonyms | FAM14D; ISG12; ISG12A; P27 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001288958, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCTCTGCTCTCACCTCATCAGCAGTGACCAGTGTGGCCAAAGTGGTCAGGGTGGCCTCTGGCT CTGCCGTAGTTTTGCCCCTGGCCAGGATTGCTACAGTTGTGATTGGAGGAGTTGTGGCTGTGCCCATGGT GCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATAGCAGCCAAGATGATGTCCGCG GCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCTACTCTGCAGTCACTGGGAGCAA CTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTGCCATTGCGGCTGTCATTGCGAG GTTCTACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288958 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001288958.1, NP_001275887.1 |
RefSeq Size | 602 bp |
RefSeq ORF | 360 bp |
Locus ID | 3429 |
Cytogenetics | 14q32.12 |
Protein Families | Transmembrane |
Gene Summary | '' Transcript Variant: This variant (7) lacks an internal segment in the 5' UTR and a 9-nt segment in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal 3 aa segment, as compared to isoform 1. Variants 2, 4, 6, 7 and 10 encode the same isoform. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235764 | IFI27 (myc-DDK-tagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review