ARFRP1 (NM_001267545) Human Untagged Clone

CAT#: SC333684

ARFRP1 (untagged) - Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 4


  "NM_001267545" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARFRP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARFRP1
Synonyms ARL18; ARP; Arp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001267545, the custom clone sequence may differ by one or more nucleotides


ATGTACACGCTGCTGTCGGGCTTGTACAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTGATCCTGG
GCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCGAAAACCCGATTTAACAAGAACTACAAGGG
GATGAGTCTATCCAAAATCACCACCACCGTGGGCCTAAACATCGGCACTGTGGATGTGGGAAAGGCTCGG
CTCATGTTCTGGGACTTAGGAGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTATTATGCGGAGTGTC
ACGGCGTCATCTACGTCATTGACTCCACCGACGAGGAGAGGCTGGCTGAGTCCAAGCAGGCGTTTGACGT
GCCTCTCAATCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001267545
ORF Size 366 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001267545.2, NP_001254474.1
RefSeq Size 2571
RefSeq ORF 366
Locus ID 10139
Gene Summary The protein encoded by this gene is a membrane-associated GTP-ase which localizes to the plasma membrane and is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) proteins. This gene plays a role in membrane trafficking between the trans-Golgi network and endosomes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
Transcript Variant: This variant (4) lacks an exon in the 3' coding region and contains an alternate segment in the 3' terminal exon, compared to variant 1, which results in a frameshift and a protein (isoform D) with a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.