ARFRP1 (NM_001267545) Human Untagged Clone
CAT#: SC333684
ARFRP1 (untagged) - Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 4
"NM_001267545" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARFRP1 |
Synonyms | ARL18; ARP; Arp1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001267545, the custom clone sequence may differ by one or more nucleotides
ATGTACACGCTGCTGTCGGGCTTGTACAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTGATCCTGG GCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCGAAAACCCGATTTAACAAGAACTACAAGGG GATGAGTCTATCCAAAATCACCACCACCGTGGGCCTAAACATCGGCACTGTGGATGTGGGAAAGGCTCGG CTCATGTTCTGGGACTTAGGAGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTATTATGCGGAGTGTC ACGGCGTCATCTACGTCATTGACTCCACCGACGAGGAGAGGCTGGCTGAGTCCAAGCAGGCGTTTGACGT GCCTCTCAATCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267545 |
ORF Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001267545.2, NP_001254474.1 |
RefSeq Size | 2571 |
RefSeq ORF | 366 |
Locus ID | 10139 |
Gene Summary | The protein encoded by this gene is a membrane-associated GTP-ase which localizes to the plasma membrane and is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) proteins. This gene plays a role in membrane trafficking between the trans-Golgi network and endosomes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012] Transcript Variant: This variant (4) lacks an exon in the 3' coding region and contains an alternate segment in the 3' terminal exon, compared to variant 1, which results in a frameshift and a protein (isoform D) with a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235790 | ARFRP1 (myc-DDK-tagged) - Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review