PGAP2 (NM_001283040) Human Untagged Clone
CAT#: SC333696
PGAP2 (untagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 19
"NM_001283040" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PGAP2 |
Synonyms | CWH43-N; FRAG1; HPMRS3; MRT17; MRT21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001283040, the custom clone sequence may differ by one or more nucleotides
ATGGCTAGATTGGGAAGCACCGGCGGGGTGTCGGGAAGGGTGGTGACGCAACATAGAGACTCCGCCCCCT TCCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGAATGGCATGG TAGATGGAACGCAGCTGAGAGCCATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCA CATGCTCCTCACCTGCATTCTCTGGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGATCGCAAGTCC TACAGCTGGAAACAGCGGCTCTTCATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTC GGCACAACATGTATTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001283040 |
ORF Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001283040.1, NP_001269969.1 |
RefSeq Size | 1460 |
RefSeq ORF | 369 |
Locus ID | 27315 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (19) uses an alternate exon structure in the 5' region compared to variant 1. The encoded isoform (11) is distinct and shorter, compared to isoform 1, but it shares regions in common with isoforms 5 and 7. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235802 | PGAP2 (myc-DDK-tagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 19 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review