TMEM273 (NM_001288742) Human Untagged Clone

CAT#: SC333706

C10orf128 (untagged) - Human chromosome 10 open reading frame 128 (C10orf128), transcript variant 4


  "NM_001288742" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM273"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM273
Synonyms C10orf128
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288742, the custom clone sequence may differ by one or more nucleotides


ATGAACTTGGGGGTCAGCATGCTGAGGATCCTCTTCCTCCTGGATGTAGGAGGAGCTCAAGTGCTGGCAA
CAGGCAAGACCCCTGGGGCTGAAATTGATTTCAAGTACGCCCTCATCGGGACTGCTGTGGGTGTCGCCAT
ATCTGCTGGCTTCCTGGCCCTGAAGATCTGCATGATCAGGAGGCACTTATTTGACGACGACTCTTCCGAC
CTGAAAAGCACGCCTGGGGGCCTCAGTGGCGAAACCACAATTTCTCCAAAAGCATCTGGCCAGATCTGTG
CAAATTCACCAACTACAGAAAGTGAAAAGTTTCCCAAAATATGCCTATTAACCTCGAGGAATGACTTCTC
TTTTTGTCATCAAAGTGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001288742
ORF Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001288742.1, NP_001275671.1
RefSeq Size 1879
RefSeq ORF 372
Locus ID 170371
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.