GPIHBP1 (NM_001301772) Human Untagged Clone

CAT#: SC333728

GPIHBP1 (untagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPIHBP1
• Synonyms: GPI-HBP1; HYPL1D
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301772, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAGC
  AGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGA
  AGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCC
  CTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTG
  CCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCAT
  CACCAAGACGGTGGAGGGGACCCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301772
• ORF Size: 378 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301772.1, NP_001288701.1
• RefSeq Size: 625
• RefSeq ORF: 378
• Locus ID: 338328
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (2) lacks a segment in the 3' UTR and 3' CDS, compared to variant 1. The encoded isoform (2) has a shorter C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.