ZNRD1 (NM_001278786) Human Untagged Clone

CAT#: SC333733

ZNRD1 (untagged) - Human zinc ribbon domain containing 1 (ZNRD1), transcript variant d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNRD1
• Synonyms: HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZR14
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278786, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGTCATGGACCTCGCCAATACTTGCTCCAGCTTTCAGTCGGACCTGGATTTCTGTTCAGATTGCG
  GCTCGGTCCTGCCTCTGCCCGGGGCTCAGGATACGGTCACCTGTATTCGCTGTGGCTTCAACATCAACGT
  TCGGGACTTTGAGGGGAAGGTTGTGAAGACTTCGGTTGTGTTCCACCAACTGGGGACAGCCATGCCTATG
  TCGGTGGAGGAAGGGCCTGAGTGCCAGGGACCTGTGGTTGACAGGCGCTGCCCTCGATGTGGTCATGAAG
  GAATGGCATACCACACCAGACAGATGCGTTCAGCCGATGAAGGGCAAACTGTCTTCTACACCTGTACCAA
  CTGCAAGTTCCAGGAGAAGGAAGACTCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278786
• ORF Size: 381 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278786.1, NP_001265715.1
• RefSeq Size: 784
• RefSeq ORF: 381
• Locus ID: 30834
• Protein Families: Transcription Factors
• Protein Pathways: Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
• Gene Summary: This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (d) differs in the 5' UTR, compared to variant 1. Variants a, b, c, and d encode the same protein.