p23 (PTGES3) (NM_001282603) Human Untagged Clone

CAT#: SC333740

PTGES3 (untagged) - Human prostaglandin E synthase 3 (cytosolic) (PTGES3), transcript variant 4


  "NM_001282603" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGES3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTGES3
Synonyms cPGES; P23; TEBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282603, the custom clone sequence may differ by one or more nucleotides


ATGCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTCTTCATTGAATTTTGTGTTGAAGACA
GTAAGGATGTTAATGTAAATTTTGAAAAATCCAAACTTACATTCAGTTGTCTCGGAGGAAGTGATAATTT
TAAGCATTTAAATGAAATTGATCTTTTTCACTGTATTGATCCAAATCTTAATTGGCTTAGTGTCGACTTC
AATAATTGGAAAGACTGGGAAGATGATTCAGATGAAGACATGTCTAATTTTGATCGTTTCTCTGAGATGA
TGAACAACATGGGTGGTGATGAGGATGTAGATTTACCAGAAGTAGATGGAGCAGATGATGATTCACAAGA
CAGTGATGATGAAAAAATGCCAGATCTGGAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282603
ORF Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282603.1, NP_001269532.1
RefSeq Size 1946
RefSeq ORF 384
Locus ID 10728
Protein Families Druggable Genome, Nuclear Hormone Receptor
Gene Summary This gene encodes an enzyme that converts prostaglandin endoperoxide H2 (PGH2) to prostaglandin E2 (PGE2). This protein functions as a co-chaperone with heat shock protein 90 (HSP90), localizing to response elements in DNA and disrupting transcriptional activation complexes. Alternative splicing results in multiple transcript variants. There are multiple pseudogenes of this gene on several different chromosomes. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (4) lacks an in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (d) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.