Fas Ligand (FASLG) (NM_001302746) Human Untagged Clone

CAT#: SC333743

FASLG (untagged) - Human Fas ligand (TNF superfamily, member 6) (FASLG), transcript variant 2


  "NM_001302746" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FASLG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FASLG
Synonyms ALPS1B; APT1LG1; APTL; CD95-L; CD95L; CD178; FASL; TNFSF6; TNLG1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302746, the custom clone sequence may differ by one or more nucleotides


ATGCAGCAGCCCTTCAATTACCCATATCCCCAGATCTACTGGGTGGACAGCAGTGCCAGCTCTCCCTGGG
CCCCTCCAGGCACAGTTCTTCCCTGTCCAACCTCTGTGCCCAGAAGGCCTGGTCAAAGGAGGCCACCACC
ACCACCGCCACCGCCACCACTACCACCTCCGCCGCCGCCGCCACCACTGCCTCCACTACCGCTGCCACCC
CTGAAGAAGAGAGGGAACCACAGCACAGGCCTGTGTCTCCTTGTGATGTTTTTCATGGTTCTGGTTGCCT
TGGTAGGATTGGGCCTGGGGATGTTTCAGCTCTTCCACCTACAGAAGGAGCTGGCAGAACTCCGAGAGGC
CACCCCAGTCCACCCCCTGAAAAAAAGGAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001302746
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302746.1, NP_001289675.1
RefSeq Size 1861 bp
RefSeq ORF 384 bp
Locus ID 356
Cytogenetics 1q24.3
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Allograft rejection, Apoptosis, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pathways in cancer, Type I diabetes mellitus
Gene Summary 'This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]'
Transcript Variant: This variant (2) lacks an exon in the 5' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.