Fas Ligand (FASLG) (NM_001302746) Human Untagged Clone

CAT#: SC333743

FASLG (untagged) - Human Fas ligand (TNF superfamily, member 6) (FASLG), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FASLG
• Synonyms: ALPS1B; APT1LG1; APTL; CD95-L; CD95L; CD178; FASL; TNFSF6; TNLG1A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302746, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCAGCCCTTCAATTACCCATATCCCCAGATCTACTGGGTGGACAGCAGTGCCAGCTCTCCCTGGG
  CCCCTCCAGGCACAGTTCTTCCCTGTCCAACCTCTGTGCCCAGAAGGCCTGGTCAAAGGAGGCCACCACC
  ACCACCGCCACCGCCACCACTACCACCTCCGCCGCCGCCGCCACCACTGCCTCCACTACCGCTGCCACCC
  CTGAAGAAGAGAGGGAACCACAGCACAGGCCTGTGTCTCCTTGTGATGTTTTTCATGGTTCTGGTTGCCT
  TGGTAGGATTGGGCCTGGGGATGTTTCAGCTCTTCCACCTACAGAAGGAGCTGGCAGAACTCCGAGAGGC
  CACCCCAGTCCACCCCCTGAAAAAAAGGAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302746
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302746.1, NP_001289675.1
• RefSeq Size: 1861 bp
• RefSeq ORF: 384 bp
• Locus ID: 356
• Cytogenetics: 1q24.3
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Allograft rejection, Apoptosis, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pathways in cancer, Type I diabetes mellitus
• Gene Summary: 'This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]'
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.