C3orf14 (NM_001291942) Human Untagged Clone

CAT#: SC333755

C3orf14 (untagged) - Human chromosome 3 open reading frame 14 (C3orf14), transcript variant 3


  "NM_001291942" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "C3orf14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C3orf14
Synonyms HT021
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291942, the custom clone sequence may differ by one or more nucleotides


ATGACTTCCTTGTTTGCTCAAGAAATTCGCCTTTCTAAAAGACATGAAGAAATAGTATCACAAAGATTAA
TGTTACTTCAACAAATGGAGAATAAATTGGGTGATCAACACACAGAAAAGGCATCTCAACTCCAAACTGT
TGAGACTGCTTTTAAAAGGAACCTTAGTCTTTTAAAGGATATAGAAGCAGCAGAAAAGTCACTACAGACC
AGGATTCACCCACTTCCACGGCCTGAGGTGGTTTCTCTTGAGACTCGTTACTGGGCATCAGTAGAAGAAT
ATATTCCCAAATGGGAACAGTTTCTTTTAGGAAGAGCACCATATCCTTTTGCTGTTGAAAATCAAAATGA
AGCAGAAAATACCATTCAAAATGAGGCACAGCGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001291942
ORF Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291942.1, NP_001278871.1
RefSeq Size 3320
RefSeq ORF 387
Locus ID 57415

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.