ACYP1 (NM_001302617) Human Untagged Clone

CAT#: SC333772

ACYP1 (untagged) - Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 4


  "NM_001302617" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACYP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACYP1
Synonyms ACYPE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302617, the custom clone sequence may differ by one or more nucleotides


ATGCCGGCGTCCGCCCGCCTGGCGGGAGCGGGGCTGCTGCTGGCCTTTCTCCGCGCGCTCGGCTGCGCTG
GGCGGGCCCCAGGTTTGAGCATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAA
GGTGCAAGGGGTGTTTTTCCGTAAGCATACTCAGGCTGAGGGTAAAAAGCTGGGATTGGTAGGCTGGGTC
CAGAACACTGACCGGGGCACAGTGCAAGGACAATTGCAAGGTCCCATCTCCAAGGTGCGTCATATGCAGG
AATGGCTTGAAACAAGAGGAAGTCCTAAATCACACATCGACAAAGCAAACTTCAACAATGAAAAAGTCAT
CTTGAAGTTGGATTACTCAGACTTCCAAATTGTAAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001302617
ORF Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001302617.1, NP_001289546.1
RefSeq Size 815
RefSeq ORF 390
Locus ID 97
Protein Pathways Pyruvate metabolism
Gene Summary This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) uses an upstream alternate 5' terminal exon and lacks an alternate exon, compared to variant 1. The encoded isoform (c) has a longer N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.