ZNF302 (NM_001289190) Human Untagged Clone

CAT#: SC333793

ZNF302 (untagged) - Human zinc finger protein 302 (ZNF302), transcript variant 12


  "NM_001289190" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF302"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF302
Synonyms HSD16; MST154; MSTP154; ZNF135L; ZNF140L; ZNF327
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289190, the custom clone sequence may differ by one or more nucleotides


ATGTCTCAGGTGACATTTAGTGATGTGGCTATAGACTTCTCTCATGAAGAGTGGGCATGCCTAGATTCTG
CTCAGAGGGACTTATACAAGGATGTGATGGTCCAGAATTATGAGAACCTGGTCTCTGTAGGTCTTTCCGT
AACTAAGCCATATGTGATCATGTTATTGGAGGATGGAAAAGAGCCCTGGATGATGGAGAAAAAACTGTCA
AAAGCTTACCCATTTCCTTTATCACACTCTGTTCCTGCTTCTGTGAACTTTGGATTCTCTGCTCTATTTG
AGCATTGTTCAGAAGTCACTGAAATATTTGAGTTGTCAGAACTATGTGTTTTCTGGGTGCTTCATTTCTT
ATCCAATTCTCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001289190
ORF Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001289190.1, NP_001276119.1
RefSeq Size 2888
RefSeq ORF 396
Locus ID 55900
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the zinc-finger protein family. The encoded protein contains seven C2H2-type zinc fingers and a KRAB domain, but its function has yet to be determined. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (12) differs in the 5' UTR, lacks an alternate in-frame exon, and uses an alternate splice junction compared to variant 1. The resulting isoform (e) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Variants 12, 13, 14, and 15 all encode the same isoform (e).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.