FAM107B (NM_001282696) Human Untagged Clone

CAT#: SC333799

FAM107B (untagged) - Human family with sequence similarity 107, member B (FAM107B), transcript variant 3


  "NM_001282696" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM107B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM107B
Synonyms C10orf45; HITS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282696, the custom clone sequence may differ by one or more nucleotides


ATGGCCGAGCCAGACTACATAGAAGATGACAATCCTGAACTCATTAGGCCTCAGAAACTGATCAATCCTG
TAAAAACCTCCCGGAACCATCAAGATCTTCACAGAGAACTTCTTATGAATCAAAAAAGGGGTCTTGCTCC
TCAGAACAAACCAGAATTGCAGAAGGTGATGGAAAAAAGAAAACGAGACCAAGTAATAAAGCAGAAGGAA
GAAGAAGCACAGAAGAAGAAATCTGACTTGGAAATAGAGCTATTAAAACGGCAGCAGAAGTTGGAGCAGC
TTGAACTTGAGAAGCAGAAATTGCAAGAAGAGCAAGAAAATGCCCCCGAGTTTGTGAAGGTGAAAGGCAA
TCTCAGGAGAACAGGCCAAGAAGTCGCCCAAGCCCAGGAGTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282696
ORF Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282696.1, NP_001269625.1
RefSeq Size 3357
RefSeq ORF 396
Locus ID 83641

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.