ZNF302 (NM_001289188) Human Untagged Clone

CAT#: SC333813

ZNF302 (untagged) - Human zinc finger protein 302 (ZNF302), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF302
• Synonyms: HSD16; MST154; MSTP154; ZNF135L; ZNF140L; ZNF327
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001289188, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTCAGGTGACATTTAGTGATGTGGCTATAGACTTCTCTCATGAAGAGTGGGCATGCCTAGATTCTG
  CTCAGAGGGACTTATACAAGGATGTGATGGTCCAGAATTATGAGAACCTGGTCTCTGTAGCAGGTCTTTC
  CGTAACTAAGCCATATGTGATCATGTTATTGGAGGATGGAAAAGAGCCCTGGATGATGGAGAAAAAACTG
  TCAAAAGCTTACCCATTTCCTTTATCACACTCTGTTCCTGCTTCTGTGAACTTTGGATTCTCTGCTCTAT
  TTGAGCATTGTTCAGAAGTCACTGAAATATTTGAGTTGTCAGAACTATGTGTTTTCTGGGTGCTTCATTT
  CTTATCCAATTCTCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289188
• ORF Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001289188.1, NP_001276117.1
• RefSeq Size: 2957
• RefSeq ORF: 399
• Locus ID: 55900
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the zinc-finger protein family. The encoded protein contains seven C2H2-type zinc fingers and a KRAB domain, but its function has yet to be determined. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2014]
  Transcript Variant: This variant (10) differs in the 5' UTR, uses an alternate in-frame splice junction, lacks an alternate in-frame exon, and uses another alternate splice junction compared to variant 3. The resulting isoform (d) lacks an alternate internal segment, contains an additional internal aa, and has a shorter and distinct C-terminus compared to isoform a. Variants 10 and 11 both encode the same isoform (d).