AIG1 (NM_001286589) Human Untagged Clone
CAT#: SC333849
AIG1 (untagged) - Human androgen-induced 1 (AIG1), transcript variant 4
"NM_001286589" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AIG1 |
Synonyms | AIG-1; dJ95L4.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286589, the custom clone sequence may differ by one or more nucleotides
ATGGCGCTTGTCCCCTGCCAGGTGCTGCGGATGGCAATCCTGCTGTCTTACTGCTCTATCCTGTGTAACT ACAAGGCCATCGAAATGCCCTCACACCAGACCTACGGAGGGAGCTGGAAATTCCTGACGTTCATTGATCT GGTTATCCAGGCTGTCTTTTTTGGCATCTGTGTGCTGACTGATCTTTCCAGTCTTCTGACTCGAGGAAGT GGGAACCAGGAGCAAGAGAGGCAGCTCAAGAAGCTCATCTCTCTCCGGGACTGGATGTTAGCTGTGTTGG CCTTTCCTGTTGGGGTTTTTGTTGTAGCAGTGTTCTGGATCATTTATGCCTATGACAGAGAGATGATATA CCCGAAGCTGCTGGATAATTTTATCCCAGGGTGGCTGAATCACGGAATGCATTTCAAAGCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286589 |
ORF Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001286589.1, NP_001273518.1 |
RefSeq Size | 3474 |
RefSeq ORF | 414 |
Locus ID | 51390 |
Protein Families | Transmembrane |
Gene Summary | May play a role in androgen-regulated growth of hair follicles. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks multiple 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235955 | AIG1 (myc-DDK-tagged) - Human androgen-induced 1 (AIG1), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review