TCTP (TPT1) (NM_001286273) Human Untagged Clone
CAT#: SC333852
TPT1 (untagged) - Human tumor protein, translationally-controlled 1 (TPT1), transcript variant 3
"NM_001286273" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TPT1 |
Synonyms | HRF; p02; p23; TCTP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286273, the custom clone sequence may differ by one or more nucleotides
ATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCG AGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAAC AAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAA GAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTA ATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTA CCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286273 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286273.1, NP_001273202.1 |
RefSeq Size | 4575 bp |
RefSeq ORF | 417 bp |
Locus ID | 7178 |
Cytogenetics | 13q14.13 |
Gene Summary | 'This gene encodes a protein that is a regulator of cellular growth and proliferation. Its mRNA is highly structured and contains an oligopyrimidine tract (5'-TOP) in its 5' untranslated region that functions to repress its translation under quiescent conditions. The encoded protein is involved in a variety of cellular pathways, including apoptosis, protein synthesis and cell division. It binds to and stabilizes microtubules, and removal of this protein through phosphorylation is required for progression through mitotic and meiotic cell divisions. This gene is known to play a role in carcinogenesis, and is upregulated in some cancer cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1, including initiation of translation at a downstream in-frame start codon. The encoded isoform (3) has shorter N- and C-termini, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235958 | TPT1 (myc-DDK-tagged) - Human tumor protein, translationally-controlled 1 (TPT1), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review