Apc11 (ANAPC11) (NM_001289420) Human Untagged Clone

CAT#: SC333882

ANAPC11 (untagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 14

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ANAPC11
• Synonyms: APC11; Apc11p; HSPC214
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001289420, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGTG
  GCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGTCCTCTCCATGGAGAAAGCATTTCTAGGTG
  TTTGGGCTGGTGCCCGCAGCCTGTGCCTGTCCTGGGAGGCAGGGCCCATCCACAGGCAAGGTGCCCGGCG
  ACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCA
  CGCACAGCAGGTGCAGCAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGAGGCCCGACC
  TGGCTCTCGCTGGAGGGGCATCCTGAGACTCCTTCCTCATGCTGGCGCCGATGGCTGCTGGGGACAGCGC
  CCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289420
• ORF Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001289420.1, NP_001276349.1
• RefSeq Size: 1063
• RefSeq ORF: 426
• Locus ID: 51529
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
• Gene Summary: Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (14) lacks an exon and contains two alternate exons in the 5' UTR, and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1.