DIABLO (NM_001278302) Human Untagged Clone
CAT#: SC333892
DIABLO (untagged) - Human diablo, IAP-binding mitochondrial protein (DIABLO), transcript variant 5
"NM_001278302" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DIABLO |
Synonyms | DFNA64; SMAC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278302, the custom clone sequence may differ by one or more nucleotides
ATGAAATCTGACTTCTACTTCCAGGCTGTTTATACCTTAACTTCTCTTTACCGACAATATACAAGTTTAC TTGGGAAAATGAATTCAGAGGAGGAAGATGAAGTGTGGCAGGTGATCATAGGAGCCAGAGCTGAGATGAC TTCAAAACACCAAGAGTACTTGAAGCTGGAAACCACTTGGATGACTGCAGTTGGTCTTTCAGAGATGGCA GCAGAAGCTGCATATCAAACTGGCGCAGATCAGGCCTCTATAACCGCCAGGAATCACATTCAGCTGGTGA AACTGCAGGTGGAAGAGGTGCACCAGCTCTCCCGGAAAGCAGAAACCAAGCTGGCAGAAGCACAGATAGA AGAGCTCCGTCAGAAAACACAGGAGGAAGGGGAGGAGCGGGCTGAGTCGGAGCAGGAGGCCTACCTGCGT GAGGATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278302 |
ORF Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001278302.1, NP_001265231.1 |
RefSeq Size | 1853 |
RefSeq ORF | 429 |
Locus ID | 56616 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (5) differs in its 5' UTR and 5' coding region, uses an alternate start codon, and lacks an in-frame exon in the internal coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235998 | DIABLO (myc-DDK-tagged) - Human diablo, IAP-binding mitochondrial protein (DIABLO), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review