HSPA14 (NM_001278205) Human Untagged Clone

CAT#: SC333904

HSPA14 (untagged) - Human heat shock 70kDa protein 14 (HSPA14), transcript variant 3


  "NM_001278205" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSPA14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSPA14
Synonyms HSP70-4; HSP70L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278205, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCATCGGAGTTCACCTGGGCTGCACCTCAGCCTGTGTGGCCGTCTATAAGGATGGCCGGGCTG
GTGTGGTTGCAAATGATGCCGGTGACCGAGTTACTCCAGCTGTTGTTGCTTACTCAGAAAATGAAGAGAT
TGTTGGATTGGCAGCAAAACAAAGTAGAATAAGAAATATTTCAAATACAGTAATGAAAGTAAAGCAGATC
CTGGGCAGAAGGGTGCTCTCAAGGGACCCCCAGCTACAGCAGCTCCCACAGCCTTTTCAGAGGTGCAGTT
GCTCCCTGTCAGAGCAGCCCCATGGCCAGACTGGGTGTGTCCGGGGAGCCCAGCCCCTGCACCAGCACCA
ACCGCAGCACTCCTGGGGTAGCCTCCACACCGCAGACTCCAGTCTCCTCTTCGAGAGCTGGTTTTGTTTC
TGGTGGGGATAG


Restriction Sites SgfI-MluI     
ACCN NM_001278205
ORF Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278205.1, NP_001265134.1
RefSeq Size 4110
RefSeq ORF 432
Locus ID 51182
Protein Families Druggable Genome, Stem cell - Pluripotency

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.