METTL11A (NTMT1) (NM_001286801) Human Untagged Clone

CAT#: SC333923

NTMT1 (untagged) - Human N-terminal Xaa-Pro-Lys N-methyltransferase 1 (NTMT1), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NTMT1
• Synonyms: AD-003; C9orf32; HOMT1A; METTL11A; NRMT; NRMT1; NTM1A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286801, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACGAGCGAGGTGATAGAAGACGAGAAGCAATTCTATTCCAAGGCCAAGACCTACTGGAAACAAATCC
  CACCCACGGTGGACGGCATGCTTGGGGGGTATGGCCACATCTCCAGCATCGACATCAACAGCTCCCGGAA
  GTTTCTGCAGAGGTTTTTGAGGGAAGGCCCGAACAAGACAGGAACGTCCTGTGCCCTGGACTGTGGAGCT
  GGCATTGGGAGGATCACCAAGCGGCTGCTCCTGCCGCTGTTCAGAGAGGTGGATATGGTCGACATAACGG
  AGGACTTCCTGGTTCAAGCCAAGACCTACCTGGGGGAGGAGGGCAAGAGGGCCACCTCACCGATCAGCAC
  CTGGCCGAGTTCCTGCGGCGCTGCAAGGGCAGCCTCCGCCCCAACGGCATCATCGTCATCAAAGACAACA
  TGGCCCAGGAGGGCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286801
• ORF Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286801.1, NP_001273730.1
• RefSeq Size: 1477
• RefSeq ORF: 438
• Locus ID: 28989
• Protein Families: Druggable Genome
• Gene Summary: The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200). [supplied by OMIM, Nov 2010]
  Transcript Variant: This variant (7) differs in the 5' UTR, and uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Both variants 6 and 7 encode isoform b.