Endothelin 2 (EDN2) (NM_001302269) Human Untagged Clone

CAT#: SC333925

EDN2 (untagged) - Human endothelin 2 (EDN2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EDN2
• Synonyms: ET-2; ET2; PPET2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302269, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCTCCGTGCCTACCACCTGGTGCTCCGTTGCGCTAGCCCTGCTCGTGGCCCTGCATGAAGGGAAGG
  GCCAGGCTGCTGCCACCCTGGAGCAGCCAGCGTCCTCATCTCATGCCCAAGGCACCCACCTTCGGCTTCG
  CCGTTGCTCCTGCAGCTCCTGGCTCGACAAGGAGTGCGTCTACTTCTGCCACTTGGACATCATCTGGGTG
  AACACTCCTGAACAGACAGCTCCTTACGGCCTGGGAAACCCGCCAAGACGCCGGCGCCGCTCCCTGCCAA
  GGCGCTGTCAGTGCTCCAGTGCCAGGGACCCCGCCTGTGCCACCTTCTGCCTTCGAAGGCCCTGGGACAT
  TTCCACAGTCAAGAGCCTCTTTGCCAAGCGACAACAGGAGGCCATGCGGGAGCCTCGGTCCACACATTCC
  AGGTGGAGGAAGAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302269
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302269.1, NP_001289198.1
• RefSeq Size: 1168 bp
• RefSeq ORF: 438 bp
• Locus ID: 1907
• Cytogenetics: 1p34.2
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling events. This gene product is involved in a wide range of biological processes, such as hypertension and ovulation. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]'
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1.