RNASE4 (NM_001282192) Human Untagged Clone

CAT#: SC333937

RNASE4 (untagged) - Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNASE4
• Synonyms: RAB1; RNS4
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282192, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCTGCAGAGGACCCATTCATTGCTTCTGCTTTTGCTGCTGACCCTGCTGGGGCTGGGGCTGGTCC
  AGCCCTCCTATGGCCAGGATGGCATGTACCAGCGATTCCTGCGGCAACACGTGCACCCTGAGGAGACAGG
  TGGCAGTGATCGCTACTGCAACTTGATGATGCAAAGACGGAAGATGACTTTGTATCACTGCAAGCGCTTC
  AACACCTTCATCCATGAAGATATCTGGAACATTCGTAGTATCTGCAGCACCACCAATATCCAATGCAAGA
  ACGGCAAGATGAACTGCCATGAGGGTGTAGTGAAGGTCACAGATTGCAGGGACACAGGAAGTTCCAGGGC
  ACCCAACTGCAGATATCGGGCCATAGCGAGCACTAGACGTGTTGTCATTGCCTGTGAGGGTAACCCACAG
  GTGCCTGTGCACTTTGACGGTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282192
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282192.1, NP_001269121.1
• RefSeq Size: 1912 bp
• RefSeq ORF: 444 bp
• Locus ID: 6038
• Cytogenetics: 14q11.2
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: 'The protein encoded by this gene belongs to the pancreatic ribonuclease family. It plays an important role in mRNA cleavage and has marked specificity towards the 3' side of uridine nucleotides. Alternative splicing results in four transcript variants encoding the same protein. This gene and the gene that encodes angiogenin share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. [provided by RefSeq, Aug 2013]'
  Transcript Variant: This variant (4) represents the longest transcript. All four variants encode the same protein.