OBP2A (NM_001293193) Human Untagged Clone

CAT#: SC333949

OBP2A (untagged) - Human odorant binding protein 2A (OBP2A), transcript variant delta

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OBP2A
• Synonyms: hOBPIIa; LCN13; OBP; OBP2C; OBPIIa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293193, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGACCCTGTTCCTGGGTGTCACGCTCGGCCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGG
  ATGAGGGAGGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAGCG
  CCTATGGGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGTCTTTTACTGCAA
  AGACCAGCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGCATCTGCTCCCTGCAGGGCCGTGCCG
  CTGTCCCCACCTTGGCTCACCTGGCCACCTCACCTGCAGGTAGGAATCCTAATACCAACCTGGAGGCCCT
  GGAAGAATTTAAGAAATTGGTGCAGCACAAGGGACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGACG
  GGAAGCTGCGTTCTCGAACACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293193
• ORF Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001293193.1, NP_001280122.1
• RefSeq Size: 620
• RefSeq ORF: 444
• Locus ID: 29991
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (delta, PMID:10607840) has multiple differences in the coding region, one of which results in an internal translational frameshift, compared to variant gamma. The resulting protein (isoform delta) has a distinct internal coding region but shares the same N- and C-terminus as isoform gamma.