MAGP2 (MFAP5) (NM_001297711) Human Untagged Clone
CAT#: SC333955
MFAP5 (untagged) - Human microfibrillar associated protein 5 (MFAP5), transcript variant 4
"NM_001297711" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MFAP5 |
Synonyms | AAT9; MAGP-2; MAGP2; MFAP-5; MP25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297711, the custom clone sequence may differ by one or more nucleotides
ATGTCGCTCTTGGGACCCAAGGTGCTGCTGTTTCTTGCTGCATTCATCATCACCTCTGACTGGATACCCC TGGGGGTCAATAGTCAACGAGGAGACGATGTGACTCAAGCGACTCCAGAAACATTCACAGAAGATCCTAA TCTGGTGAATGATCCCGCTACAGATGAAACAGAGTGCTGGGATGAGAAATTTACCTGCACAAGGCTCTAC TCTGTGCATCGGCCGGTTAAACAATGCATTCATCAGTTATGCTTCACCAGTTTACGACGTATGTACATCG TCAACAAGGAGATCTGCTCTCGTCTTGTCTGTAAGGAACACGAAGCTATGAAAGATGAGCTTTGCCGTCA GATGGCTGGTCTGCCCCCTAGGAGACTCCGTCGCTCCAATTACTTCCGACTTCCTCCCTGTGAAAATGTG GATTTGCAGAGACCCAATGGTCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297711 |
ORF Size | 447 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001297711.1, NP_001284640.1 |
RefSeq Size | 2874 |
RefSeq ORF | 447 |
Locus ID | 8076 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a 25-kD microfibril-associated glycoprotein which is a component of microfibrils of the extracellular matrix. The encoded protein promotes attachment of cells to microfibrils via alpha-V-beta-3 integrin. Deficiency of this gene in mice results in neutropenia. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) lacks two alternate in-frame exons in the coding region compared to variant 1. The encoded isoform (d) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236061 | MFAP5 (myc-DDK-tagged) - Human microfibrillar associated protein 5 (MFAP5), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review