MAGP2 (MFAP5) (NM_001297711) Human Untagged Clone

CAT#: SC333955

MFAP5 (untagged) - Human microfibrillar associated protein 5 (MFAP5), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MFAP5
• Synonyms: AAT9; MAGP-2; MAGP2; MFAP-5; MP25
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297711, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGCTCTTGGGACCCAAGGTGCTGCTGTTTCTTGCTGCATTCATCATCACCTCTGACTGGATACCCC
  TGGGGGTCAATAGTCAACGAGGAGACGATGTGACTCAAGCGACTCCAGAAACATTCACAGAAGATCCTAA
  TCTGGTGAATGATCCCGCTACAGATGAAACAGAGTGCTGGGATGAGAAATTTACCTGCACAAGGCTCTAC
  TCTGTGCATCGGCCGGTTAAACAATGCATTCATCAGTTATGCTTCACCAGTTTACGACGTATGTACATCG
  TCAACAAGGAGATCTGCTCTCGTCTTGTCTGTAAGGAACACGAAGCTATGAAAGATGAGCTTTGCCGTCA
  GATGGCTGGTCTGCCCCCTAGGAGACTCCGTCGCTCCAATTACTTCCGACTTCCTCCCTGTGAAAATGTG
  GATTTGCAGAGACCCAATGGTCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297711
• ORF Size: 447 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297711.1, NP_001284640.1
• RefSeq Size: 2874
• RefSeq ORF: 447
• Locus ID: 8076
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a 25-kD microfibril-associated glycoprotein which is a component of microfibrils of the extracellular matrix. The encoded protein promotes attachment of cells to microfibrils via alpha-V-beta-3 integrin. Deficiency of this gene in mice results in neutropenia. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (4) lacks two alternate in-frame exons in the coding region compared to variant 1. The encoded isoform (d) is shorter than isoform a.