VSTM1 (NM_001288791) Human Untagged Clone
CAT#: SC333961
VSTM1 (untagged) - Human V-set and transmembrane domain containing 1 (VSTM1), transcript variant 2
"NM_001288791" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | VSTM1 |
Synonyms | SIRL-1; SIRL1; UNQ3033 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001288791, the custom clone sequence may differ by one or more nucleotides
ATGAGAAAAAGAATGGGTCCCACTCGGTTGCCCAGGCTGGAGTGCAGTGGTGCAATCACAGCTCACTGCA GCCTTGACCTCCCAGGCCCAGATAAACACGATGAACTTGAAGCTCCCTCAATGAAAACAGACACCAGAAC CATCTTTGTCGCCATCTTCAGCTGCATCTCCATCCTTCTCCTCTTCCTCTCAGTCTTCATCATCTACAGA TGCAGCCAGCACAGTTCATCATCTGAGGAATCCACCAAGAGAACCAGCCATTCCAAACTTCCGGAGCAGG AGGCTGCCGAGGCAGATTTATCCAATATGGAAAGGGTATCTCTCTCGACGGCAGACCCCCAAGGAGTGAC CTATGCTGAGCTAAGCACCAGCGCCCTGTCTGAGGCAGCTTCAGACACCACCCAGGAGCCCCCAGGATCT CATGAATATGCGGCACTGAAAGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288791 |
ORF Size | 447 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001288791.1, NP_001275720.1 |
RefSeq Size | 825 |
RefSeq ORF | 447 |
Locus ID | 284415 |
Protein Families | Transmembrane |
Gene Summary | Isoform 1: Inhibitory immune receptor involved in the regulation of phagocytes. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks one exon and contains an alternate exon in the 5' coding region, which results in a frameshift and use of an alternate start codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236067 | VSTM1 (myc-DDK-tagged) - Human V-set and transmembrane domain containing 1 (VSTM1), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review