VSTM1 (NM_001288791) Human Untagged Clone

CAT#: SC333961

VSTM1 (untagged) - Human V-set and transmembrane domain containing 1 (VSTM1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VSTM1
• Synonyms: SIRL-1; SIRL1; UNQ3033
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001288791, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAAAAAGAATGGGTCCCACTCGGTTGCCCAGGCTGGAGTGCAGTGGTGCAATCACAGCTCACTGCA
  GCCTTGACCTCCCAGGCCCAGATAAACACGATGAACTTGAAGCTCCCTCAATGAAAACAGACACCAGAAC
  CATCTTTGTCGCCATCTTCAGCTGCATCTCCATCCTTCTCCTCTTCCTCTCAGTCTTCATCATCTACAGA
  TGCAGCCAGCACAGTTCATCATCTGAGGAATCCACCAAGAGAACCAGCCATTCCAAACTTCCGGAGCAGG
  AGGCTGCCGAGGCAGATTTATCCAATATGGAAAGGGTATCTCTCTCGACGGCAGACCCCCAAGGAGTGAC
  CTATGCTGAGCTAAGCACCAGCGCCCTGTCTGAGGCAGCTTCAGACACCACCCAGGAGCCCCCAGGATCT
  CATGAATATGCGGCACTGAAAGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001288791
• ORF Size: 447 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001288791.1, NP_001275720.1
• RefSeq Size: 825
• RefSeq ORF: 447
• Locus ID: 284415
• Protein Families: Transmembrane
• Gene Summary: Isoform 1: Inhibitory immune receptor involved in the regulation of phagocytes. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks one exon and contains an alternate exon in the 5' coding region, which results in a frameshift and use of an alternate start codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct N-terminus, compared to isoform 1.