Syntaxin 6 (STX6) (NM_001286210) Human Untagged Clone

CAT#: SC333999

STX6 (untagged) - Human syntaxin 6 (STX6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STX6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286210, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAGATCAGATGTCAACTTCATCTGTGCAGGCATTAGCTGAAAGAAAAAATAGACAGGCACTGCTGG
  GAGACAGTGGCAGCCAGAACTGGAGCACTGGAACAACAGATAAATATGGGCGTCTGGACCGAGAGCTCCA
  GAGAGCCAATTCTCATTTCATTGAGGAGCAGCAGGCACAGCAGCAGTTGATCGTGGAACAGCAGGATGAG
  CAGTTGGAGCTGGTCTCTGGCAGCATCGGGGTGCTGAAGAACATGTCCCAGCGCATCGGAGGGGAGCTGG
  AGGAACAGGCAGTTATGTTGGAAGATTTCTCTCACGAATTGGAGAGCACTCAGTCCCGGCTGGACAATGT
  GATGAAGAAACTTGCAAAAGTATCTCATATGACCAGTGATCGGCGCCAATGGTGTGCCATAGCCATCCTC
  TTTGCAGTCCTGTTGGTTGTGCTCATCCTCTTCTTAGTGCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286210
• ORF Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286210.1, NP_001273139.1
• RefSeq Size: 4809
• RefSeq ORF: 465
• Locus ID: 10228
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: Involved in intracellular vesicle trafficking. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.