Sigma1 receptor (SIGMAR1) (NM_001282205) Human Untagged Clone

CAT#: SC334012

SIGMAR1 (untagged) - Human sigma non-opioid intracellular receptor 1 (SIGMAR1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SIGMAR1
• Synonyms: ALS16; DSMA2; hSigmaR1; OPRS1; SIG-1R; sigma1R; SR-BP; SR-BP1; SRBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282205, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCGGTGCTGACCC
  AGGTCGTCTGGCTCTGGCTGGGTACGCAGAGCTTCGTCTTCCAGCGCGAAGAGATAGCGCAGTTGGCGCG
  GCAGTACGCTGGGCTGGACCACGAGCTGGCCTTCTCTCGTCTGATCGTGGAGCTGCGGCGGCTGCACCCA
  GGCCACGTGCTGCCCGACGAGGAGCTGCAGTGGGTGTTCGTGAATGCGGGTGGCTGGATGGGCGCCATGT
  GCCTTCTGCACGCCTCGCTGTCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCCGCGGCCACTC
  GGGGCGCTACTGGGCTGAGATCTCGGATACCATCATCTCTGGCACCTTCCACCAGTGGAGAGAGGGCACC
  ACCAAAAGTGAGGTCTTCTACCCAGGACCCTTGACCAGCCAGGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282205
• ORF Size: 468 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282205.1, NP_001269134.1
• RefSeq Size: 1510
• RefSeq ORF: 468
• Locus ID: 10280
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Gene Summary: This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (6) uses an alternate splice site in the 3'-terminal exon, compared to variant 1. The encoded isoform (6) has a shorter and distinct C-terminus, compared to isoform 1.