DCTN3 (NM_001281425) Human Untagged Clone
CAT#: SC334043
DCTN3 (untagged) - Human dynactin 3 (p22) (DCTN3), transcript variant 3
"NM_001281425" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DCTN3 |
Synonyms | DCTN-22; DCTN22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001281425, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGGC CGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAACAT TTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGATCCT GAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGCCGTTCCTGAGC ATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGACCAGTGTGTGGAAATCACTGA GGAGTCCAAGGCTCTCCTGGAGGAATACAACAAGACTACAATGCTTCTCTCCAAGCAATTCGTGCAGTGG GATGAGCTACTTTGCCAGCTAGAGGCCGCCACGCAAGTGAAGCCAGCAGAGGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281425 |
ORF Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001281425.1, NP_001268354.1 |
RefSeq Size | 773 |
RefSeq ORF | 477 |
Locus ID | 11258 |
Gene Summary | This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236149 | DCTN3 (myc-DDK-tagged) - Human dynactin 3 (p22) (DCTN3), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review