DCTN3 (NM_001281425) Human Untagged Clone

CAT#: SC334043

DCTN3 (untagged) - Human dynactin 3 (p22) (DCTN3), transcript variant 3


  "NM_001281425" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DCTN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DCTN3
Synonyms DCTN-22; DCTN22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281425, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGGC
CGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAACAT
TTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGATCCT
GAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGCCGTTCCTGAGC
ATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGACCAGTGTGTGGAAATCACTGA
GGAGTCCAAGGCTCTCCTGGAGGAATACAACAAGACTACAATGCTTCTCTCCAAGCAATTCGTGCAGTGG
GATGAGCTACTTTGCCAGCTAGAGGCCGCCACGCAAGTGAAGCCAGCAGAGGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281425
ORF Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001281425.1, NP_001268354.1
RefSeq Size 773
RefSeq ORF 477
Locus ID 11258
Gene Summary This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.