DIABLO (NM_001278303) Human Untagged Clone

CAT#: SC334103

DIABLO (untagged) - Human diablo, IAP-binding mitochondrial protein (DIABLO), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DIABLO
• Synonyms: DFNA64; SMAC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278303, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGAGAGCAGTGTCTTTGGTAACAGATAGCACCTCTACCTTTCTCTCTCAGACCACATATGCGTTGA
  TTGAAGCTATTACTGAATATACTAAGGCTGTTTATACCTTAACTTCTCTTTACCGACAATATACAAGTTT
  ACTTGGGAAAATGAATTCAGAGGAGGAAGATGAAGTGTGGCAGGTGATCATAGGAGCCAGAGCTGAGATG
  ACTTCAAAACACCAAGAGTACTTGAAGCTGGAAACCACTTGGATGACTGCAGTTGGTCTTTCAGAGATGG
  CAGCAGAAGCTGCATATCAAACTGGCGCAGATCAGGCCTCTATAACCGCCAGGAATCACATTCAGCTGGT
  GAAACTGCAGGTGGAAGAGGTGCACCAGCTCTCCCGGAAAGCAGAAACCAAGCTGGCAGAAGCACAGATA
  GAAGAGCTCCGTCAGAAAACACAGGAGGAAGGGGAGGAGCGGGCTGAGTCGGAGCAGGAGGCCTACCTGC
  GTGAGGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278303
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278303.1, NP_001265232.1
• RefSeq Size: 1881
• RefSeq ORF: 501
• Locus ID: 56616
• Protein Families: Transmembrane
• Gene Summary: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (5, also known as Smac-gamma) has a shorter N-terminus, compared to isoform 1.