GGT6 (NM_001288704) Human Untagged Clone

CAT#: SC334107

GGT6 (untagged) - Human gamma-glutamyltransferase 6 (GGT6), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GGT6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001288704, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCGGGCAGAAGAGCCCGTGGTCTATCAGAAGCTGCTGCCCTGGGAGCCAAGCTTGGAGTCGGAGG
  AGGAAGTGGAGGAGGAGGAGACATCAGAGGCGCTGGTTCTAAACCCCCGGAGGCACCAGGACTCTTCCAG
  GAACAAGGCTGGCGGGCTGCCCGGAACCTGGGCCCGTGTAGTGGCAGCCCTGCTGCTGCTGGCTGTTGGC
  TGCTCCCTGGCTGTGAGGCAGCTCCAGAATCAGGGCAGGTCGACAGGAAGCTTGGGCTCTGTGGCCCCTC
  CACCCGGCGGACACTCCCACGGCCCTGGCGTATACCACCACGGTGCCATCATCAGCCCTGCAGACTGCTG
  TGAGCCCCGAGAGCAGTGCCCTGGCCGCCGTGGACAGCAGCGGCTCTGTGCTCCTTCTCACCTCCTCGCT
  CAACTGCTCCTTTGGCTCTGCACACCTGTCCCCAAGCACTGGGGTTCTGCTCAGCAACCTGGTGGCCAAG
  TCTACCACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001288704
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001288704.1, NP_001275633.1
• RefSeq Size: 1966
• RefSeq ORF: 501
• Locus ID: 124975
• Protein Pathways: Arachidonic acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Metabolic pathways, Selenoamino acid metabolism, Taurine and hypotaurine metabolism
• Gene Summary: GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]). [supplied by OMIM, Oct 2008]
  Transcript Variant: This variant (5) lacks an alternate exon in the 5' coding region and uses an alternate splice site in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 3. It encodes isoform e, which is shorter and has a distinct C-terminus compared to isoform c.