FRA1 (FOSL1) (NM_001300857) Human Untagged Clone

CAT#: SC334129

FOSL1 (untagged) - Human FOS-like antigen 1 (FOSL1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FOSL1
• Synonyms: FRA; fra-1; FRA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300857, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGC
  CCCCGGCCGCAGCGCAGGCAGCCCAGCAGGAGACTGACAAACTGGAAGATGAGAAATCTGGGCTGCAGCG
  AGAGATTGAGGAGCTGCAGAAGCAGAAGGAGCGCCTAGAGCTGGTGCTGGAAGCCCACCGACCCATCTGC
  AAAATCCCGGAAGGAGCCAAGGAGGGGGACACAGGCAGTACCAGTGGCACCAGCAGCCCACCAGCCCCCT
  GCCGCCCTGTACCTTGTATCTCCCTTTCCCCAGGGCCTGTGCTTGAACCTGAGGCACTGCACACCCCCAC
  ACTCATGACCACACCCTCCCTAACTCCTTTCACCCCCAGCCTGGTCTTCACCTACCCCAGCACTCCTGAG
  CCTTGTGCCTCAGCTCATCGCAAGAGTAGCAGCAGCAGCGGAGACCCATCCTCTGACCCCCTTGGCTCTC
  CAACCCTCCTCGCTTTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300857
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300857.1, NP_001287786.1
• RefSeq Size: 1453
• RefSeq ORF: 510
• Locus ID: 8061
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Wnt signaling pathway
• Gene Summary: The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (5) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (5) has the same N- and C-termini but is shorter compared to isoform 1.