SENP7 (NM_001282804) Human Untagged Clone

CAT#: SC334131

SENP7 (untagged) - Human SUMO1/sentrin specific peptidase 7 (SENP7), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SENP7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282804, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTAAATGCAAAACCAGAGGATGTCCATGTTCAATCACCACTGTCCAAATTCAGAAGCTCAGAACGCT
  GGACTCTCCCTTTGCAGTGGGAAAGAAGCCTAAGGAATAAAGTCATCTCTCTAGACCATAAAAATAAAAA
  ACATATCCGAGGGTGTCCTGTTACTTCCAAGTCATCACCAGAAAGGCAACTCAAAGTTATGTTGACGAAT
  GTCCTATGGACGGATTTAGGACGAAAATTCAGAAAGACCCTACCTAGAAACGATGCTAATTTATGTGATG
  CCAACAAGGTGCAATCAGACTCATTGCCTTCGACATCTGTTGACAGCCTAGAGACATGTCAAAAATTAGA
  ACCTCTTCGCCAAAGCCTTAATTTATCTGAAAGGGGCTCACAACGAAGTAAGACAGTAGATGACAATTCT
  GCAAAGCAGACTGCGCACAATAAAGAAAAACGAAGAAAGGATGATGGCATTTCTCTTTTAATATCTGATA
  CTCAGCCTGAAGGTTTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282804
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282804.1, NP_001269733.1
• RefSeq Size: 827
• RefSeq ORF: 510
• Locus ID: 57337
• Protein Families: Druggable Genome, Protease
• Gene Summary: The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for many cellular processes. SUMO-specific proteases, such as SENP7, process SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]). [supplied by OMIM, Jun 2009]
  Transcript Variant: This variant (6) differs in its 5' UTR, initiates translation at a downstream start codon, lacks several exons, and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (6) is shorter and has a distinct C-terminus, compared to isoform 1.