TPM1 (NM_001301289) Human Untagged Clone
CAT#: SC334807
TPM1 (untagged) - Human tropomyosin 1 (alpha) (TPM1), transcript variant Tpm1.8
"NM_001301289" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TPM1 |
Synonyms | C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001301289, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGAGTAGCTCGCTGGAGGCGGTGCGCAGGAAGATCCGGAGCCTGCAGGAGCAGGCGGACGCCG CTGAGGAGCGCGCGGGCACCCTGCAGCGCGAGCTGGACCACGAGAGGAAGCTGAGGGAGACCGCTGAAGC CGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTG GCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCA TTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCA CATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTG GAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTG TGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACTCGCAGAAGGAAGACAGATATGAGGA AGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTA ACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTA TGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301289 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301289.1, NP_001288218.1 |
RefSeq Size | 1629 bp |
RefSeq ORF | 747 bp |
Locus ID | 7168 |
Cytogenetics | 15q22.2 |
Protein Families | Druggable Genome |
Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM) |
Gene Summary | 'This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (Tpm1.8, also known as variant 9) contains alternate in-frame exons in the 5' and 3' coding region, compared to variant Tpm1.1. It encodes isoform Tpm1.8cy, which has distinct N- and C-termini and is shorter than isoform Tpm1.1st. Variants Tpm1.8, Tpm1.9 and Tpm1.13 encode isoforms that are the same length, but have distinct protein sequences. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236913 | TPM1 (myc-DDK-tagged) - Human tropomyosin 1 (alpha) (TPM1), transcript variant Tpm1.8 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review