MC2 receptor (MC2R) (NM_001291911) Human Untagged Clone

CAT#: SC335171

MC2R (untagged) - Human melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MC2R
• Synonyms: ACTHR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291911, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCACATTATCAACTCGTATGAAAACATCAACAACACAGCAAGAAATAATTCCGACTGTCCTCGTG
  TGGTTTTGCCGGAGGAGATATTTTTCACAATTTCCATTGTTGGAGTTTTGGAGAATCTGATCGTCCTGCT
  GGCTGTGTTCAAGAATAAGAATCTCCAGGCACCCATGTACTTTTTCATCTGTAGCTTGGCCATATCTGAT
  ATGCTGGGCAGCCTATATAAGATCTTGGAAAATATCCTGATCATATTGAGAAACATGGGCTATCTCAAGC
  CACGTGGCAGTTTTGAAACCACAGCCGATGACATCATCGACTCCCTGTTTGTCCTCTCCCTGCTTGGCTC
  CATCTTCAGCCTGTCTGTGATTGCTGCGGACCGCTACATCACCATCTTCCACGCACTGCGGTACCACAGC
  ATCGTGACCATGCGCCGCACTGTGGTGGTGCTTACGGTCATCTGGACGTTCTGCACGGGGACTGGCATCA
  CCATGGTGATCTTCTCCCATCATGTGCCCACAGTGATCACCTTCACGTCGCTGTTCCCGCTGATGCTGGT
  CTTCATCCTGTGCCTCTATGTGCACATGTTCCTGCTGGCTCGATCCCACACCAGGAAGATCTCCACCCTC
  CCCAGAGCCAACATGAAAGGGGCCATCACACTGACCATCCTGCTCGGGGTCTTCATCTTCTGCTGGGCCC
  CCTTTGTGCTTCATGTCCTCTTGATGACATTCTGCCCAAGTAACCCCTACTGCGCCTGCTACATGTCTCT
  CTTCCAGGTGAACGGCATGTTGATCATGTGCAATGCCGTCATTGACCCCTTCATATATGCCTTCCGGAGC
  CCAGAGCTCAGGGACGCATTCAAAAAGATGATCTTCTGCAGCAGGTACTGGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291911
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291911.1, NP_001278840.1
• RefSeq Size: 3681 bp
• RefSeq ORF: 894 bp
• Locus ID: 4158
• Cytogenetics: 18p11.21
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: 'MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. Alternate transcript variants have been found for this gene. [provided by RefSeq, May 2014]'
  Transcript Variant: This variant (2) has an alternate 5' UTR exon, compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.