GBGT1 (NM_001288572) Human Untagged Clone

CAT#: SC335196

GBGT1 (untagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 4


  "NM_001288572" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GBGT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GBGT1
Synonyms A3GALNT; FS; UNQ2513
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288572, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTGCACTACAAGAGGGAGAAGCCACTCCAGCCCGTGGTATGGTCACAGTACCCTCAGCCCAAGC
TGCTGGAGCACAGGCCCACACAGCTGCTGACACTCACACCCTGGTTGGCGCCCATCGTCTCCGAGGGAAC
CTTCAACCCAGAGCTTCTGCAGCACATCTACCAGCCACTGAACCTGACCATTGGGGTCACGGTGTTTGCC
GTGGGGAAGTACACTCATTTCATCCAGTCCTTCCTGGAGTCAGCCGAGGAGTTCTTCATGCGTGGGTACC
GGGTGCACTACTACATCTTCACTGACAACCCTGCAGCCGTTCCCGGGGTCCCGCTGGGTCCCCACCGGCT
TCTCAGCTCCATCCCCATCCAGGGTCACTCCCACTGGGAGGAGACATCCATGCGCCGGATGGAGACCATC
AGCCAGCACATTGCTAAGAGGGCTCACCGGGAGGTGGACTACCTCTTCTGCCTTGATGTGGACATGGTGT
TTCGGAACCCGTGGGGCCCTGAGACCTTGGGAGACCTGGTGGCTGCCATTCACCCAAGCTACTACGCCGT
TCCCCGCCAGCAGTTCCCCTATGAGCGCAGGCGTGTTTCCACTGCCTTTGTGGCAGACAGCGAAGGGGAC
TTCTATTATGGTGGGGCAGTCTTCGGGGGGCAGGTGGCCAGGGTATATGAGTTTACTAGGGGCTGCCACA
TGGCCATCCTGGCGGACAAGGCCAATGGCATCATGGCTGCCTGGCGGGAGGAAAGCCACCTGAACCGTCA
CTTCATCTCAAACAAGCCGTCCAAGGTGCTGTCCCCCGAGTACCTCTGGGACGACAGGAAGCCCCAGCCA
CCCAGCCTGAAGCTGATCCGCTTTTCTACACTGGACAAGGATATCAGCTGCCTGAGGAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001288572
ORF Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001288572.1, NP_001275501.1
RefSeq Size 2035
RefSeq ORF 903
Locus ID 26301
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Metabolic pathways
Gene Summary This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.