CAPZB (NM_001282162) Human Untagged Clone

CAT#: SC335206

CAPZB (untagged) - Human capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CAPZB
• Synonyms: CAPB; CAPPB; CAPZ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282162, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCACCCAAGCAGGCGCAGCCTCCCCTTCCCTCTGAACTGTCAGCTTGCAAGGGTTGGAACTGCTGATT
  ATGGAAGTCCCTCGGATCAGAGTGATCAGCAGCTGGACTGTGCCTTGGACCTAATGAGGCGCCTGCCTCC
  CCAGCAAATCGAGAAAAACCTCAGCGACCTGATCGACCTGGTCCCCAGTCTATGTGAGGATCTCCTGTCT
  TCTGTTGACCAGCCACTGAAAATTGCCAGAGACAAGGTGGTGGGAAAGGATTACCTTTTGTGTGACTACA
  ACAGAGATGGGGACTCCTATAGGTCACCATGGAGTAACAAGTATGACCCTCCCTTGGAGGATGGGGCCAT
  GCCGTCAGCTCGGCTGAGAAAGCTGGAGGTGGAAGCCAACAATGCCTTTGACCAGTATCGAGACCTGTAT
  TTTGAAGGTGGCGTCTCATCTGTCTACCTCTGGGATCTGGATCATGGCTTTGCTGGAGTGATCCTCATAA
  AGAAGGCTGGAGATGGATCAAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTAGAAGTGCAGGA
  GAAATCCAGCGGTCGCACCGCCCATTACAAGTTGACCTCCACGGTGATGCTGTGGCTGCAGACCAACAAA
  TCTGGCTCTGGCACCATGAACCTCGGAGGCAGCCTTACCAGACAGATGGAGAAGGATGAAACTGTGAGTG
  ACTGCTCCCCACACATAGCCAACATCGGGCGCCTGGTAGAGGACATGGAAAATAAAATCAGAAGTACGCT
  GAACGAGATCTACTTTGGAAAAACAAAGGATATCGTCAATGGGCTGAGGTCTGTGCAGACTTTTGCAGAC
  AAATCAAAACAAGAAGCTCTGAAGAATGACCTGGTGGAGGCTTTGAAGAGAAAGCAGCAATGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282162
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282162.1, NP_001269091.1
• RefSeq Size: 2109 bp
• RefSeq ORF: 906 bp
• Locus ID: 832
• Cytogenetics: 1p36.13
• Gene Summary: 'This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. A pseudogene of this gene is located on the long arm of chromosome 2. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Aug 2013]'
  Transcript Variant: This variant (4) uses an alternate 5' terminal exon, and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate AUG and result in an isoform (4) with a longer and distinct N-terminus, compared to isoform 1.