PRKACB (NM_001300916) Human Untagged Clone
CAT#: SC335219
PRKACB (untagged) - Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 11
"NM_001300916" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRKACB |
Synonyms | PKA C-beta; PKACB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300916, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCTTATAGAGAACCACCTTGTAACCAGTATACAGGTACAACTACAGCTCTTCAGAAATTGGAAG GTTTTGCTAGCCGGTTATTTCATAGACACTCTAAAGGTACTGCACATGATCAGAAAACAGCTCTGGAAAA TGACAGCCTTCATTTCTCTGAACATACTGCCTTATGGGACAGATCAATGAAAGAGTTTCTAGCCAAAGCC AAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGA AAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTGAACAGTATTA TGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAA AGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATT TATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAG TGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCCATTCACTAGACCTC ATCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTG GGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAAT AATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCA GCTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTTATGAAAAGATTGTTTCTGGAAAGAACT TTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300916 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300916.1, NP_001287845.1 |
RefSeq Size | 2023 bp |
RefSeq ORF | 915 bp |
Locus ID | 5567 |
Cytogenetics | 1p31.1 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway |
Gene Summary | 'The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (11) differs in the 3' exon structure, compared to variant 1. The encoded isoform (11) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237325 | PRKACB (myc-DDK-tagged) - Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 11 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review