ADA2a (TADA2A) (NM_001291918) Human Untagged Clone

CAT#: SC335224

TADA2A (untagged) - Human transcriptional adaptor 2A (TADA2A), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TADA2A
• Synonyms: ADA2; ADA2A; hADA2; KL04P; TADA2L
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291918, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCGTTTGGGTTCCTTTAGCAATGATCCCTCTGATAAGCCACCTTGCCGAGGCTGCTCCTCCTACC
  TCATGGAGCCTTATATCAAGTGTGCTGAATGTGGGCCACCTCCTTTTTTCCTCTGCTTGCAGTGTTTCAC
  TCGAGGCTTTGAGTACAAGAAACATCAAAGCGATCATACTTATGAAATAATGACTTCAGATTTTCCTGTC
  CTTGATCCCAGCTGGACTGCTCAAGAAGAAATGGCCCTTTTAGAAGCTGTGATGGACTGTGGCTTTGGAA
  ATTGGCAGGATGTAGCCAATCAAATGTGCACCAAGACCAAGGAGGAGTGTGAGAAGCACTATATGAAGCA
  TTTCATCAATAACCCTCTGTTTGCATCTACCCTGCTGAACCTGAAACAAGCAGAGGAAGCAAAAACTGCT
  GACACAGCCATTCCATTTCACTCTACAGATGACCCTCCCCGACCTACCTTTGACTCCTTGCTTTCTCGGG
  ACATGGCCGGGTACATGCCAGCTCGAGCAGATTTCATTGAGGAATTTGACAATTATGCAGAATGGGACTT
  GAGAGACATTGATTTTGTTGAAGATGACTCGGACATTTTACATGCTCTGAAGATGGCTGTGGTAGATATC
  TATCATTCCAGGTTAAAGGAGAGACAAAGACGAAAAAAAATTATAAGAGACCATGGATTAATCAACCTTA
  GAAAGTTTCAATTAATGGAACGGCGGTATCCCAAGGAGGTCCAGGACCTGTATGAAACAATGAGGCGATT
  TGCAAGAATTGTGGGGCCAGTGGAACATGACAAATTCATTGAAAGCCATGCATGTAGGTGGTTTTTGAGC
  CTTGAGCAGTATTTGTGTGTGTATATTTATATAAATAGGAGAGATAATGGTGTGTTTTATGTGAAGTTCT
  ATAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291918
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291918.1, NP_001278847.1
• RefSeq Size: 1119 bp
• RefSeq ORF: 918 bp
• Locus ID: 6871
• Cytogenetics: 17q12
• Protein Families: Transcription Factors
• Gene Summary: 'Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (4) differs in the 5' UTR and represents an alternate transcript termination and polyadenylation site compared to variant 1. This results in a shorter isoform (b) which has a distinct C-terminus compared to isoform a. Variants 2 and 4 both encode the same isoform (b).