G protein alpha 12 (GNA12) (NM_001282440) Human Untagged Clone

CAT#: SC335231

GNA12 (untagged) - Human guanine nucleotide binding protein (G protein) alpha 12 (GNA12), transcript variant 2


  "NM_001282440" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GNA12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNA12
Synonyms gep; NNX3; RMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282440, the custom clone sequence may differ by one or more nucleotides


ATGGCTCCACGAGCAGGGCTCGGAGCTGGCCCTCTCCTGCTTCGGAGCCGCGCTGACTGGGTGTGTGGCG
GATGGGAGGCCGCCCTGAGTGCTCCTCCTCCCTTTTGTACAGCCTGGGTGGAAAGGACGGGCCTGGTGCA
CTTCCTGCGGGAGGGAGGACATGGGGCCTGCTTCCCTCTGGCGCTCCTCCACCCGGGCAGCGTGGTTTCT
TTCCAAATGATTTATCCTCTCATCGTCCTGCCGCTCTGTGCTTCATGGCATTGGGGTCTTATCCGGAAGG
GGATTGTCCTTTTTTGGGGGGAGTCGGTGAAGTACTTCCTGGACAACTTGGACCGGATCGGCCAGCTGAA
TTACTTTCCTAGTAAGCAAGATATCCTGCTGGCTAGGAAAGCCACCAAGGGAATTGTGGAGCATGACTTC
GTTATTAAGAAGATCCCCTTTAAGATGGTGGATGTGGGCGGCCAGCGGTCCCAGCGCCAGAAGTGGTTCC
AGTGCTTCGACGGGATCACGTCCATCCTGTTCATGGTCTCCTCCAGCGAGTACGACCAGGTCCTCATGGA
GGACAGGCGCACCAACCGGCTGGTGGAGTCCATGAACATCTTCGAGACCATCGTCAACAACAAGCTCTTC
TTCAACGTCTCCATCATTCTCTTCCTCAACAAGATGGACCTCCTGGTGGAGAAGGTGAAGACCGTGAGCA
TCAAGAAGCACTTCCCGGACTTCAGGGGCGACCCGCACAGGCTGGAGGACGTCCAGCGCTACCTGGTCCA
GTGCTTCGACAGGAAGAGACGGAACCGCAGCAAGCCACTCTTCCACCACTTCACCACCGCCATCGACACC
GAGAACGTCCGCTTCGTGTTCCATGCTGTGAAAGACACCATCCTGCAGGAGAACCTGAAGGACATCATGC
TGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282440
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282440.1, NP_001269369.1
RefSeq Size 4246 bp
RefSeq ORF 918 bp
Locus ID 2768
Cytogenetics 7p22.3-p22.2
Protein Families Druggable Genome
Protein Pathways Long-term depression, MAPK signaling pathway, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
Gene Summary ''
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus compare to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.