BARD1 (NM_001282548) Human Untagged Clone
CAT#: SC335242
BARD1 (untagged) - Human BRCA1 associated RING domain 1 (BARD1), transcript variant 4
"NM_001282548" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BARD1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282548, the custom clone sequence may differ by one or more nucleotides
ATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGCGC CCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCACAGTCGCGCCGCGCTCGACCGCCTGGAGAAGCT GCTGCGCTGCTCGCGTTGTAATATATTTGGTCTGCGGCCTGTCGATTATACAGATGATGAAAGTATGAAA TCGCTATTGCTGCTACCAGAGAAGAATGAATCATCCTCAGCTAGCCACTGCTCAGTAATGAACACTGGGC AGCGTAGGGATGGACCTCTTGTACTTATAGGCAGTGGGCTGTCTTCAGAACAACAGAAAATGCTCAGTGA GCTTGCAGTAATTCTTAAGGCTAAAAAATATACTGAGTTTGACAGTACAGTAACTCATGTTGTTGTTCCT GGTGATGCAGTTCAAAGTACCTTGAAGTGTATGCTTGGGATTCTCAATGGATGCTGGATTCTAAAATTTG AATGGGTAAAAGCATGTCTACGAAGAAAAGTATGTGAACAGGAAGAAAAGTATGAAATTCCTGAAGGTCC ACGCAGAAGCAGGCTCAACAGAGAACAGCTGTTGCCAAAGCTGTTTGATGGATGCTACTTCTATTTGTGG GGAACCTTCAAACACCATCCAAAGGACAACCTTATTAAGCTCGTCACTGCAGGTGGGGGCCAGATCCTCA GTAGAAAGCCCAAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTCGCATACCATGCGAGACCCGA TTCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGTAATTATCACCCAGAGAGGGTT CGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGTGTGATGTCCTTTGAGTTGCTTC CTCTTGACAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282548 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282548.1, NP_001269477.1 |
RefSeq Size | 4113 bp |
RefSeq ORF | 924 bp |
Locus ID | 580 |
Cytogenetics | 2q35 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]' Transcript Variant: This variant (4) lacks five consecutive exons in the coding region, compared to variant 1. The resulting isoform (4, also known as delta) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237348 | BARD1 (myc-DDK-tagged) - Human BRCA1 associated RING domain 1 (BARD1), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review