CGK2 (PRKG2) (NM_001282482) Human Untagged Clone
CAT#: SC335275
PRKG2 (untagged) - Human protein kinase, cGMP-dependent, type II (PRKG2), transcript variant 4
"NM_001282482" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRKG2 |
Synonyms | cGK2; cGKII; PKG2; PRKGR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282482, the custom clone sequence may differ by one or more nucleotides
ATGTCTAACTGGAAGCTGTCCAAAGCACTCTCTCTGGAAATGATTCAGCTGAAGGAGAAGGTTAAAGTAA AAAATGAGAATGTTGCTTTTGCTATGAAGTGTATAAGGAAGAAGCACATAGTTGACACCAAGCAGCAGGA GCATGTCTACTCAGAGAAGAGGATCCTAGAGGAGCTGTGCTCTCCATTCATTGTGAAATTATATCGTACT TTCAAGGACAATAAGTATGTATACATGCTTCTGGAGGCCTGCTTAGGTGGGGAGCTCTGGAGTATATTAA GGGACAGAGGCAGCTTTGATGAACCCACCTCCAAATTCTGCGTTGCTTGTGTGACAGAAGCATTTGATTA CCTGCATCGACTAGGTATTATCTACAGAGACTTGAAACCAGAAAACTTAATTCTAGATGCTGAGGGTTAC CTTAAATTGGTTGACTTTGGATTTGCGAAGAAAATAGGGTCTGGACAGAAAACATGGACATTCTGTGGGA CTCCAGAATATGTAGCTCCTGAAGTCATTCTCAACAAGGGACATGACTTCAGTGTGGATTTCTGGTCACT GGGAATTCTAGTGTATGAGCTCCTAACGGGCAACCCACCCTTTTCTGGGGTTGACCAAATGATGACCTAC AATTTGATTCTCAAAGGAATTGAAAAAATGGATTTTCCCAGGAAGATAACACGACGACCTGAGGATTTGA TTCGGAGGCTTTGCAGGCAAAATCCAACAGAAAGGCTGGGAAATCTGAAGAATGGAATAAATGACATTAA GAAACACAGGTGGTTAAATGGTTTTAATTGGGAGGGACTGAAAGCACGGAGCCTTCCATCACCTTTGCAA AGAGAGCTCAAGGGACCCATAGATCACAGCTACTTTGACAAATATCCTCCTGAAAAGGGAATGCCTCCAG ATGAGCTATCAGGCTGGGATAAAGACTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282482 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282482.1, NP_001269411.1 |
RefSeq Size | 3684 bp |
RefSeq ORF | 942 bp |
Locus ID | 5593 |
Cytogenetics | 4q21.21 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Gap junction, Long-term depression, Olfactory transduction |
Gene Summary | 'This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein binds to and inhibits the activation of several receptor tyrosine kinases. The membrane-bound protein is a regulator of intestinal secretion, bone growth and renin secretion. Alternate splicing results in multiple transcript variants encoding distinct isoforms whose regulatory N-termini differ in length but whose C-terminal catalytic domains are identical. [provided by RefSeq, May 2018]' Transcript Variant: This variant (4) represents the use of an alternate promoter, and has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon compared to variant 1. The resulting isoform (c) has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237381 | PRKG2 (myc-DDK-tagged) - Human protein kinase, cGMP-dependent, type II (PRKG2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review