CRF1 (CRHR1) (NM_001303020) Human Untagged Clone

CAT#: SC335284

CRHR1 (untagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1i


  "NM_001303020" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CRHR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRHR1
Synonyms CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303020, the custom clone sequence may differ by one or more nucleotides


ATGGTGTCCGCTACAATACCACAAAAAAAAAGCAAGGTGCACTACCATGTCGCAGTCATCATCAACTACC
TGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTCTTTCTGCGGCTCAGGAGCATCCG
GTGCCTGCGAAACATCATCCACTGGAACCTCATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTCGTG
GTCCAGCTAACCATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCT
ACAACTACTTCCATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGT
GCTCACCTACTCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCC
ATCATTGTGGCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTG
GGGTGTACACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTT
CAACATCGTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAG
GCTGTGAAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCG
GGGAGGATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTT
TGTGTCTGTGTTCTACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGG
CAGGACAAGCACTCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCA
GCTTTCACAGCATCAAGCAGTCCACAGCAGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001303020
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303020.1, NP_001289949.1
RefSeq Size 2508 bp
RefSeq ORF 945 bp
Locus ID 1394
Cytogenetics 17q21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
Gene Summary 'This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]'
Transcript Variant: This variant (1i) lacks two alternate exons, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant 1b. The encoded isoform (1i-B) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.