CRF1 (CRHR1) (NM_001303020) Human Untagged Clone
CAT#: SC335284
CRHR1 (untagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1i
"NM_001303020" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CRHR1 |
Synonyms | CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303020, the custom clone sequence may differ by one or more nucleotides
ATGGTGTCCGCTACAATACCACAAAAAAAAAGCAAGGTGCACTACCATGTCGCAGTCATCATCAACTACC TGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTCTTTCTGCGGCTCAGGAGCATCCG GTGCCTGCGAAACATCATCCACTGGAACCTCATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTCGTG GTCCAGCTAACCATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCT ACAACTACTTCCATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGT GCTCACCTACTCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCC ATCATTGTGGCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTG GGGTGTACACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTT CAACATCGTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAG GCTGTGAAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCG GGGAGGATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTT TGTGTCTGTGTTCTACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGG CAGGACAAGCACTCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCA GCTTTCACAGCATCAAGCAGTCCACAGCAGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303020 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303020.1, NP_001289949.1 |
RefSeq Size | 2508 bp |
RefSeq ORF | 945 bp |
Locus ID | 1394 |
Cytogenetics | 17q21.31 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Long-term depression, Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]' Transcript Variant: This variant (1i) lacks two alternate exons, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant 1b. The encoded isoform (1i-B) is shorter and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237390 | CRHR1 (myc-DDK-tagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1i |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review