GTF2A1 (NM_001278940) Human Untagged Clone
CAT#: SC335348
GTF2A1 (untagged) - Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 3
"NM_001278940" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GTF2A1 |
Synonyms | TF2A1; TFIIA; TFIIA-42; TFIIAL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278940, the custom clone sequence may differ by one or more nucleotides
ATGCAGTCCAGGGCAGTAGATGGATTTCATTCAGAAGAGCAGCAGCTTCTACTGCAAGTTCAACAGCAGC ATCAACCCCAGCAGCAGCAGCATCACCACCATCACCATCATCAGCAAGCTCAGCCTCAGCAGACAGTACC TCAGCAAGCGCAGACCCAGCAGGTTCTTATTCCTGCATCACAGCAAGCCACAGCACCACAAGTTATTGTT CCAGATTCTAAGTTGATACAGCATATGAATGCATCAAACATGAGTGCTGCTGCTACAGCTGCTACCTTAG CACTCCCTGCAGGTGTGACTCCTGTTCAGCAGATATTAACAAATTCAGGCCAGCTTCTTCAGGTGGTCAG AGCAGCCAATGGTGCCCAATATATCTTTCAGCCTCAGCAGTCAGTGGTTCTACAACAACAGGTTATACCA CAAATGCAGCCTGGTGGAGTACAAGCTCCTGTTATACAGCAGGTGCTGGCTCCTCTTCCTGGAGGGATTT CACCACAGACAGGTGTCATCATCCAGCCTCAGCAAATCTTATTTACAGGAAATAAGACTCAAGTTATACC TACGACAGTGGCAGCACCTACACCAGCCCAAGCACAGATAACTGCAACTGGCCAGCAGCAACCGCAGGCC CAGCCTGCTCAAACACAAGCTCCATTGGTCTTACAAGTTGATGGAACTGGGGATACATCATCTGAAGAAG ATGAAGATGAAGAAGAAGACTATGATGATGATGAGGAGGAAGACAAAGAGAAAGATGGAGCTGAAGATGG GCAGGTGGAAGAAGAGCCCCTCAATAGTGAAGATGATGTGAGTGATGAGGAAGGACAGGAACTCTTTGAC ACAGAAAATGTTGTTGTATGCCAATATGATAAGATACACAGAAGTAAAAACAAATGGAAATTTCATCTCA AGGATGGCATTATGAATCTTAATGGAAGAGATTATATATTTTCCAAAGCCATTGGAGATGCAGAATGGTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278940 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278940.1, NP_001265869.1 |
RefSeq Size | 6403 bp |
RefSeq ORF | 981 bp |
Locus ID | 2957 |
Cytogenetics | 14q31.1 |
Protein Families | Transcription Factors |
Protein Pathways | Basal transcription factors |
Gene Summary | 'Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]' Transcript Variant: This variant (3) includes an alternate exon and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237454 | GTF2A1 (myc-DDK-tagged) - Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review