GBGT1 (NM_001282632) Human Untagged Clone

CAT#: SC335385

GBGT1 (untagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 3


  "NM_001282632" in other vectors (1)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GBGT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GBGT1
Synonyms A3GALNT; FS; UNQ2513
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282632, the custom clone sequence may differ by one or more nucleotides


ATGCATCGCCGGAGACTGGCCCTGGGTCTGGGGTTCTGCCTGTTGGCGGGCACAAGCCTCAGTGTCCTGT
GGGTGTATCTTGAGAACTGGCTGCCAGTCTCCTATGTCCCCTATTATCTCCCCTGCCCAGAGATCTTGTC
ACAGTACCCTCAGCCCAAGCTGCTGGAGCACAGGCCCACACAGCTGCTGACACTCACACCCTGGTTGGCG
CCCATCGTCTCCGAGGGAACCTTCAACCCAGAGCTTCTGCAGCACATCTACCAGCCACTGAACCTGACCA
TTGGGGTCACGGTGTTTGCCGTGGGGAAGTACACTCATTTCATCCAGTCCTTCCTGGAGTCAGCCGAGGA
GTTCTTCATGCGTGGGTACCGGGTGCACTACTACATCTTCACTGACAACCCTGCAGCCGTTCCCGGGGTC
CCGCTGGGTCCCCACCGGCTTCTCAGCTCCATCCCCATCCAGGGTCACTCCCACTGGGAGGAGACATCCA
TGCGCCGGATGGAGACCATCAGCCAGCACATTGCTAAGAGGGCTCACCGGGAGGTGGACTACCTCTTCTG
CCTTGATGTGGACATGGTGTTTCGGAACCCGTGGGGCCCTGAGACCTTGGGAGACCTGGTGGCTGCCATT
CACCCAAGCTACTACGCCGTTCCCCGCCAGCAGTTCCCCTATGAGCGCAGGCGTGTTTCCACTGCCTTTG
TGGCAGACAGCGAAGGGGACTTCTATTATGGTGGGGCAGTCTTCGGGGGGCAGGTGGCCAGGGTATATGA
GTTTACTAGGGGCTGCCACATGGCCATCCTGGCGGACAAGGCCAATGGCATCATGGCTGCCTGGCGGGAG
GAAAGCCACCTGAACCGTCACTTCATCTCAAACAAGCCGTCCAAGGTGCTGTCCCCCGAGTACCTCTGGG
ACGACAGGAAGCCCCAGCCACCCAGCCTGAAGCTGATCCGCTTTTCTACACTGGACAAGGATATCAGCTG
CCTGAGGAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282632
ORF Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282632.1, NP_001269561.1
RefSeq Size 1934
RefSeq ORF 993
Locus ID 26301
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Metabolic pathways
Gene Summary This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.